Cardiovasc Diabetol (2011) 10:42

2021/05/21

Cardiovasc Diabetol (2011) 10:42. doi:10.1186/1475-2840-10-42, 5. Cataln V, Gmez-Ambrosi J, Rodrguez A, Ramrez B, Valent V, Moncada R, et al. Carbohydrate ingestion was significantly higher for OBD as compared to OB (p = 0.038) and E (p = 0.001).

Reidy K, Kang HM, Hostetter T, Susztak K. Molecular Mechanisms of Diabetic Kidney Disease. Palmer AK, Tchkonia T, LeBrasseur NK, Chini EN, Xu M, Kirkland JL. 29. Furthermore, studies have shown that IL-4 and IL-13 mediated IL-4 receptor (IL-4R) signaling in both mouse and human neutrophils inhibits their migration and effector functions in vitro and in vivo (3840). Height was measured using a wall-mounted stadiometer with a precision of 0.1cm, and the weight was taken using a calibrated manual scale (Filizola S.A., So Paulo, SP, Brazil) with a precision of 0.1kg. However, there is currently no complete understanding of the signs that trigger senescence and, although P16ink4a appears to be one of the main factors in senescence, more information is needed to determine the exact role of each factor in this process (54). Immunosenescence has a number of hallmark features such as increased activities of immune cells and progressive decline in the functional activity of phagocytic cells, natural killer cells, lymphoproliferative response and mitogen-stimulated cytokine production (1618), accumulation of late-differentiated subsets of T lymphocyte accompanied by lowered proportions of nave T cells and seropositivity for latent cytomegalovirus (CMV) and Epstein-Barr virus (EBV) infections (15, 18, 19), these changes being associated with poor vaccine efficacy, decreased immune surveillance and increased morbidity and mortality as a result of infectious diseases (1921). Table3 Correlations between physical fitness and body composition with gene expression of the immunosenescence markers of obese diabetic (OBD) or Obese without associated disease (OB) or Eutrophic (E) middle-aged individuals. Genes Nutr (2013) 8:4. doi:10.1007/s12263-012-0329-z, 66. Cytokine Growth Factor Rev (2021) 59:9. doi:10.1016/j.cytogfr.2021.01.006, 19. Thus, according to other studies that also found an increase in IL-4 associated with obesity (42), we speculate that increased expression of IL-4 in the obese groups compared to lean subjects may be due to a compensatory mechanism trying to maintain cell functions, homeostasis and tissue integrity. IUBMB Life (2007) 59:7. doi:10.1080/15216540701488358, 53. In addition, the expression of P16ink4a increases markedly with aging in most mouse tissues and in human skin and kidney tissues (45, 46), which suggests the importance of this tumor suppressor in aging and senescence (47, 48). Curr Opin Immunol (2018) 54:11522. Figure1 Gene expression of leptin (A), IL-2 (B), IL-4 (C), CD27 (D), IL-10 (E), TNF- (F), PD-1 (G), CD28 (H), IL-6 (I), P16ink4a (J) and CCR7 (K) in PBMCs of obese diabetic (OBD) or Obese without associated disease (OB) or Eutrophic (E) middle-aged individuals. Canepa ET, Scassa ME, Ceruti JM, Marazita MC, Carcagno AL, Sirkin PF, et al. All authors contributed to manuscript revision, read, and approved the submitted version. 61. Ressler S, Bartkova J, Niederegger H, Bartek J, Scharffetter-Kochanek K, Jansen-Durr P, et al. In agreement with these finding, studies have shown that obesity and diabetes accelerate biological ageing and consequently the appearance of age-related diseases especially through premature induction of the senescent state (26, 3133). Hum Immunol (1984) 9:1. doi:10.1016/0198-8859(84)90006-5, 57. All the experimental methods and procedures adhered to the Helsinki declaration and were all approved by the local University Research Ethics Committee (CAAE: 55952516.6.0000.5404). Procedures Recommendation I: Accurate Assessment of Muscular Strength and Power. Salvestrini V, Sell C, Lorenzini A. Obesity May Accelerate the Aging Process. Tuning the Cytokine Responses: An Update on Interleukin (IL)-4 and IL-13 Receptor Complexes. Paradoxical Effects of Obesity on T Cell Function During Tumor Progression and PD-1 Checkpoint Blockade. Several studies have proposed that the central mechanism underlying obesity and its related comorbidities comes from a persistent state of low-grade chronic inflammation together with dysregulation in the inflammation-stress feedback mechanisms (46), mainly due to increased production of pro-inflammatory markers such as leptin, interleukin-6 (IL-6), tumor necrosis factor - (TNF-), C-reactive protein (CRP) and monocyte chemotactic protein - 1 (MCP1) in the withe adipose tissue, together with the M1 macrophage phenotype infiltration in this tissue associated with obesity (68).

Pradella F, Boldrini VO, Marques AM, Moraes GAD, Francelin C, Cocenza RS, et al. Ventura MT, Casciaro M, Gangemi S, Buquicchio R. Immunosenescence in Aging: Between Immune Cells Depletion and Cytokines Up-Regulation. Larbi A, Fulop T. From Truly Nave to Exhausted Senescent T Cells: When Markers Predict Functionality. Leptin Functions in Infectious Diseases. CCR7 Maintains Nonresolving Lymph Node and Adipose Inflammation in Obesity. Coronavirus (SARS-CoV-2) and the Risk of Obesity for Critically Illness and ICU Admitted: Meta-Analysis of the Epidemiological Evidence. As for the list of primers, the following 5 and 3 sequences were used: HPRT (forward: GACCAGTCAACAGGGGACAT, reverse: AACACTTCGTGGGGTCCTTTTC); Leptin (forward: GGCTTTGGTCCTATCTGTCTTATGTTC; reverse: CCTGTTGATAGACTGCCAGAGTCTG); CD27 (forward: ACTACTGGGCTCAGGGAAAGCT; reverse: GGATCACACTGAGCAGCCTTTC); CD28 (forward: GAGAAGAGCAATGGAACCATTATC; reverse: TAGCAAGCCAGGACTCCACCAA); P16INK4a (forward: GGGGGCACCAGAGGCAGT; reverse: GGTTGTGGCGGGGGCAGTT); PD1 (forward: CGTGGCCTATCCACTCCTCA; reverse: ATCCCTTGTCCCAGCCACTC); IL-2 (forward: GAATCCCAAACTCACCAGGATGCTC; reverse: TAGCACTTCCTCCAGAGGTTTGAGT); IL-6 (forward: GGTACATCCTCGACGGCATCT; reverse: GTGCCTCTTTGCTGCTTTCAC); IL-10 (forward: CCGTGGAGCAGGTGAAGAATG; reverse: AGTCGCCACCCTGATGTCTC); IL-4 forward: AACTTTGTCCACGGACACAAGTGC; reverse: GAATCGGATCAGCTGCTTGTGCCT); CCR7 (forward: GCCCAGATGGTTTTTGGGTTC; reverse: GCAAGGTACGGATGATAATGAGG); TNF (forward: CGAGTCTGGGCAGGTCTACTTT; reverse: AAGCTGTAGGCCCCAGTGAGTT). Waist circumference was measured at the midpoint between the last ribs and the iliac crests with an inelastic metric tape, with the precision of 0.1cm. Inflammation (2014) 37:4. doi:10.1007/s10753-014-9914-1, 9. Cells (2021) 10:9. doi:10.3390/cells10092435, 16. Fulop T, Larbi A, Dupuis G, Le Page A, Frost EH, Cohen AA, et al. The Anti-Inflammatory Effects of Exercise: Mechanisms and Implications for the Prevention and Treatment of Disease. Despite this, we did not find significant differences as regard CD28 expression.

J Appl Physiol (2006) 100:3. doi:10.1152/japplphysiol.01086.2005, 51. Heeb LEM, Egholm C, Impellizzieri D, Ridder F, Boyman O. Plasma glucose analysis was performed using the GOD-Trinder method. Florindo AF, Latorre MRDO. Furthermore, all volunteers (with the exception of 1 individual in the E group) presented serum positivity for CMV. All cDNAs were placed in a set of primers and a probe marked with SYBR Green. All evaluations were performed with the volunteers under conditions of spontaneous breathing of atmospheric air, in a room with an average ambient temperature of 23 C. In order to familiarize themselves with the location, tests and equipment used, the volunteers were invited to visit the premises used for the evaluations and an explanation of the procedures to be used were given. Vida C, Gonzlez EM, de la Fuente M. Increase of Oxidation and Inflammation in Nervous and Immune Systems With Aging and Anxiety. Copyright 2022 Brunelli, Boldrini, Bonfante, Duft, Mateus, Costa, Chacon-Mikahil, Teixeira, Farias and Cavaglieri. All volunteers did not perform any systematic physical activities in the period prior to the study and were classified as irregularly active according to the Baecke questionnaire, with the times of weekly physical activity reported as follows: OBD = 65.03 8.08min; OB = 63.13 7.08min; and E = 68.50 9.30min. doi:10.1016/j.coi.2018.06.009, 39. The cardiorespiratory assessment was performed using a progressive effort protocol on a treadmill (Quinton, model TM55, USA), with a continuous collection of expired gases breath to breath (CPX Ultima, MedGraphics, USA). INK4 Proteins, a Family of Mammalian CDK Inhibitors With Novel Biological Functions. De La Fuente M, Castro NM.

Egholm C, Heeb LEM, Impellizzieri D, Boyman O. Clin Mol Allergy (2017) 15:21. doi:10.1186/s12948-017-0077-0, 36. Nutrients (2021) 13:2. doi:10.3390/nu13020610, 35. Obesity as a Model of Premature Immunosenescence.

Regulation of Neutrophils in Type 2 Immune Responses. 12:806400. doi: 10.3389/fimmu.2021.806400. Frasca D, Ferracci F, Diaz A, Romero M, Lechner S, Blomberg BB. Wang Z, Aguilar EG, Luna JI, Dunai C, Khuat LT, Le CT, et al. Obese mice knocked out for CCR7 -/- show a decrease in the accumulation of immune cells in adipose tissue, and consequently reduced inflammation. Although IL-4 plays a protective role in inflammation by suppressing pro-inflammatory cytokine production like IFN-gamma, TNF- and IL-1 (41), our results herein may indicate that obesity can contribute to a cascade of pro-inflammatory cytokines that IL-4 are unable to suppress. Cytokine (2020) 128:154989. doi:10.1016/j.cyto.2020.154989, 43. Hirao M, Onai N, Hiroishi K, Watkins SC, Matsushima K, Robbins PH, et al. Furthermore, we thank the volunteers who have participated in this study. Cataln V, Gmez-Ambrosi J, Ramirez B, Rotellar F, Pastor C, Silva C, et al. Gustafson MP, DiCostanzo AC, Wheatley CM, Kim C, Bornschlegl S, Gastineau DA, et al. Zhu D, Xu G, Ghandhi S, Hubbard K. Modulation of the Expression of P16ink4a and P14arf by hnRNP A1 and A2 RNA Binding Proteins: Implications for Cellular Senescence. J Lipid Res (2013) 54:9. doi:10.1194/jlr.M038638, 10. (58) have reported an increase in the percentage of CD27+ B cells and NK cells during aging. All the data were analyzed using the IBM SPSS Statistics 20.0 (IBM Corp. Copyright IBM Corporation, USA) software program. At the end of the extraction of the total RNA, the purity and quantity of the RNA of the samples were verified in the Gene Quant spectrophotometer (Pharmacia Biotech), paying attention to the 260/280 ratio (possible contamination with protein). Curfs JH, Meis JF, Hoogkamp-Korstanje JA. Leptin expression was significantly higher for the OBD and OB groups compared to E (p = 0.001 and p= 0.047, respectively; Figure1A) and also for OBD compared to OB (p = 0.020; Figure1A). Additionally, gene expression of IL-2 (p= 0.003 and p = 0.0001, respectively; Figure1B), IL4 (p = 0.001 and p = 0.011, respectively; Figure1C), CD27 (p = 0.014 and p = 0.043, respectively; Figure1D), IL10 (p = 0.001 and p = 0.0001, respectively; Figure1E), TNF- (p = 0.001 and p = 0.029,respectively; Figure1F), PD-1 (p = 0.006 and p = 0.003, respectively; Figure1G), P16ink4a (p = 0.014 and p = 0.029,respectively; Figure1J) and CCR7 (p = 0.0001 and p = 0.012, respectively; Figure1K) were significantly higher for OBD and OB compared to E, with no difference between OBD and OB for these same variables (p > 0.05 for all the comparisons). Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher. Front Endocrinol (2019) 10:266. doi:10.3389/fendo.2019.00266, 32. Ronan L, Alexander-Bloch AF, Wagstyl K, Farooqi S, Brayne C, Tyler LK, et al. DB, VB, and AF wrote sections of the manuscript. Maurya R, Bhattacharya P, Dey R, Nakhasi HL. Peripheral Mononuclear Blood Cells Contribute to the Obesity-Associated Inflammatory State Independently of Glycemic Status: Involvement of the Novel Proinflammatory Adipokines Chemerin, Chitinase-3-Like Protein 1, Lipocalin-2 and Osteopontin. Sheridan PA, Paich HA, Handy J, Karlsson EA, Hudgens MG, Sammon AB, et al. The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The patients/participants provided their written informed consent to participate in this study.